AJP - Heart Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Heart Circ Physiol 288: H13-H21, 2005. First published September 2, 2004; doi:10.1152/ajpheart.00629.2004
0363-6135/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/1/H13    most recent
00629.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gupte, S. A.
Right arrow Articles by Wolin, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gupte, S. A.
Right arrow Articles by Wolin, M. S.

2004 CARDIOVASCULAR AND KIDNEY INVESTIGATORS MEETING

Cytosolic NADPH may regulate differences in basal Nox oxidase-derived superoxide generation in bovine coronary and pulmonary arteries

Sachin A. Gupte, Pawel M. Kaminski, Beverly Floyd, Ritu Agarwal, Noorjahan Ali, Mansoor Ahmad, John Edwards, and Michael S. Wolin

Department of Physiology, New York Medical College, Valhalla, New York

Submitted 24 June 2004 ; accepted in final form 27 August 2004


   ABSTRACT
TOP
 ABSTRACT
MATERIALS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Because systems controlled by basal NAD(P)H oxidase activity appear to contribute to differences in responses of endothelium-removed bovine coronary (BCA) and pulmonary (BPA) arteries to hypoxia, we characterized the Nox oxidases activities present in these vascular segments and how cytosolic NAD(P)H redox systems could be controlling oxidase activity. BPA generated ~60–80% more lucigenin (5 µM) chemiluminescence detectable superoxide than BCA. Apocynin (10 µM), a NAD(P)H oxidase inhibitor, and 6-aminonicotinamide (1 mM), a pentose phosphate inhibitor (PPP), both attenuated (approximately by 50–70%) superoxide detected in BPA and BCA. There was no significant difference in the expression of Nox2 or Nox4 mRNA or protein detected by Western blot analysis. NADPH and NADH increased superoxide in homogenates and isolated microsomal membrane fractions in a manner consistent with BPA and BCA having similar levels of oxidase activity. BPA had 4.2-fold higher levels of NADPH than BCA. The activity and protein levels of glucose-6-phosphate dehydrogenase (G6PD), the rate-limiting PPP enzyme generating cytosolic NADPH, were 1.5-fold higher in BPA than BCA. Thus BPA differ from BCA in that they have higher levels of G6PD activity, NADPH, and superoxide. Because both arteries have similar levels of Nox expression and activity, elevated levels of cytosolic NADPH may contribute to increased superoxide in BPA.

glucose-6-phosphate dehydrogenase; lactate; NAD(P)H oxidase; Nox2; Nox4; pentose phosphate pathway

OUR PREVIOUS STUDIES characterized NAD(P)H oxidases in bovine pulmonary arteries (BPA) and bovine coronary arteries (BCA) in the context of examining their potential role in responses associated with changes in PO2, relaxation to both lactate and inhibiting the pentose phosphate pathway, in controlling the attenuation of relaxation to nitric oxide (NO) donors after inactivating Cu,Zn-SOD, and in stretch-induced oxidase activation (6, 9, 16–20, 22, 23). Many of these studies provided evidence based on the actions of lactate that increasing cytosolic NADH through the lactate dehydrogenase reaction was associated with increased superoxide (O2–) or H2O2-mediated signaling responses. Whereas our initial experiments using large concentrations of lucigenin to detect O2– suggested a more dominant dependence of oxidase activity on NADH compared with NADPH, elevated levels of lucigenin have subsequently been reported to shift the apparent pyridine nucleotide dependence of Nox oxidases from NADPH to NADH (15, 25). While examining how pentose phosphate pathway (PPP) inhibitors cause relaxation by lowering cytosolic NADPH, we realized that inhibition of the PPP also lowered basal levels of O2– or H2O2 release in BCA (6). In addition there is now strong evidence that most of the Nox-type oxidases utilize NADPH as a substrate for O2– production (5, 15, 25). Thus the Nox-type oxidases in BPA and BCA could potentially use both NADH and NADPH as substrates for superoxide production as a function of the availability of these intracellular metabolites.

The levels of Nox oxidase expression, activities of these NAD(P)H oxidases, and the substrates available for Nox oxidases can be hypothesized to have a very important role in controlling the expression of oxidase activity and signaling processes regulated by the species generated. However, little is known about the influence of substrate availability for Nox oxidases in cell types, which show NADH and NADPH oxidase activities. From the initial observations that BPA showed greater basal levels of O2– detected with 5 µM lucigenin, we investigated whether differences existed in the activity and expression of Nox oxidases present in these arteries or in factors such as substrate availability as a process regulating oxidase activity.


   MATERIALS
TOP
 ABSTRACT
 MATERIALS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Many of the reagents used in the present study were obtained from sources previously described (6, 9, 16–20, 22, 23). Most vasoactive and mechanistic probes were purchased from Sigma Chemical (St. Louis, MO).

Measurement of NAD(P)H, NAD(P)+, and ATP in BCA and BPA. Isolated endothelium-removed left anterior descending coronary and secondary branch of pulmonary arterial rings were prepared from slaughterhouse-derived bovine hearts and lungs and used in the study (6, 9, 16–20, 22, 23). The rings were incubated in individually thermostated (37°C) 10-ml baths (Metro Scientific) for 2 h in Krebs bicarbonate buffer (pH 7.4) containing the following (in mM): 118 NaCl, 4.7 KCl, 1.5 CaCl2, 25 NaHCO3, 1.1 MgSO4, 1.2 KH2PO4, and 5.6 glucose, gassed with 21% O2-5% CO2 (balance N2). After a 2-h equilibration period, the levels of NAD(P)H in BCA were determined by HPLC using adaptations of previously published methods (6, 7). Briefly, BCA and BPA were pretreated with and without different drugs and immediately frozen in liquid nitrogen. The frozen tissues were crushed and homogenized in an extraction medium consisting of 0.02 N NaOH, containing 0.5 mM cysteine at 0°C. The extracts were then heated at 60°C for 10 min and neutralized with 2 ml of 0.25 M glycylglycine buffer, pH 7.6. Acidic extracts were prepared by homogenizing the tissues in hot 0.1 N HCl followed by neutralization. The NAD(P)H was eluted on a reverse-phase HPLC column (4.6 x 250 mm; Bondapak C18, Shiseido) at room temperature using HP 1100 Series (Agilent Technologies) and buffer system consisting of 100 mM potassium phosphate (pH 6.0) (buffer A), and 100 mM potassium phosphate (pH 6.0) containing 5% methanol (buffer B). The column was eluted with 100% buffer A from 0 to 8.5 min, 80% buffer A plus 20% buffer B from 8.5 to 14.5 min, and 100% buffer B from 14.5 to 40 min. The flow rate was 1.0 ml/min, and the ultraviolet absorbance was monitored at 260 nm.

Determination of glucose-6-phosphate dehydrogenase activity and glucose-6-phosphate levels in BCA and BPA. Glucose-6-phosphate dehydrogenase (G6PD) activity was measured as previously described (27). Briefly, enzyme activity was determined in BPA and BCA homogenates using a plate-reader spectrophotometer (Bio-Tek PowerWave 200) by measuring the rate of increase of absorbance at 340 nm from the conversion of NADP+ to NADPH by G6PD. Substrate concentrations used were glucose-6-phosphate (G6P, 200 µM) and NADP+ (100 µM).

G6P levels were determined using the method described by Jungling et al. (11). This method was adopted after a slight modification. G6P level was determined in homogenate (50 µl) incubated in 400 µl K2HPO4 buffer (pH 7.6) containing NADP+ (27 mM), flavin mononucleotide (20 µM), G6PD (350 U/ml), and dithiothreitol (12.5 mM). After incubation for 30 min at 37°C, increase in fluorescence from the conversion of NADP+ to NADPH was estimated using fluorescence method described above.

Measurement of superoxide levels in BCA and BPA. With the use of previously described methods (6, 19, 20), BCA and BPA rings were pretreated with or without drugs in the tissue bath and were placed in plastic scintillation minivials containing 5 µM lucigenin for the detection of O2– and other additions in a final volume of 1 ml of air-equilibrated Krebs solution buffered with 10 mM HEPES-NaOH (pH 7.4).

To detect O2– in BCA and BPA homogenates and isolated microsomal membrane fractions, we employed our previously published methods (19). In brief, BPA or BCA were homogenized in the Eblerbach homogenizer after the tissue was digested in MOPS (50 mM)-surcose (250 mM) buffer (pH 7.4) containing collagenase (1 mg/ml), elastase (0.125 mg/ml), and trypsin inhibitor (0.25 mg/ml). The homogenate was filtered through cheesecloth, and 10 µl were used to estimate O2– levels.

To prepare microsomal membrane-enriched fractions, the homogenate was centrifuged at 25,000 g, and the postmitochondrial fraction was further centrifuged at 100,000 g. The pellet was redissolved in MOPS-sucrose buffer, and 10 µl of the microsomal membrane fraction were used in the assay measure O2–.

Lucigenin chemiluminescence was measured in a liquid scintillation counter (LS6000IC, Beckman Instruments) at ~37°C, and data are reported as counts per minute per gram of BCA or BPA and counts per minute per milligram of protein after background subtraction.

RNA isolation and QRT-PCR to detect Nox2 and Nox4 in BCA and BPA. Total RNA was prepared as described previously (4). QRT-PCR was performed to quantify mRNA levels. With the use of total RNA, a reverse transcription reaction was carried out using oligo-dT and SuperScript III (Invitrogen; Calsbad, CA). The first-strand cDNAs were amplified and message levels quantified by real-time detection using a Stratagene MX3000p (Strategene, La Jolla, CA). The housekeeping gene {beta}-actin was used for normalization. Sequences of oligonucleotides from 5' to 3' for Nox2 and Nox4 were GCAGGAG AAGAACAACACGGCTGCTTATTAAGGGTGTCAGCC and ATCACTGAACTATGAGGTTAGCCTGGTCTGTTCTCTTGCCAAAACT, respectively.

Western blot analysis to determine Nox2 and Nox4 in BCA and BPA. BCA and BPA homogenates for Western blot analysis was prepared using previously published methods (22). Briefly, frozen arterial segments were pulverized under liquid nitrogen and placed in a homogenization buffer [60 mM Tris, 10 mM EGTA, 2 mM EDTA, protease inhibitor cocktails (Sigma), pH 7.5]. The tubes were centrifuged at 14,000 rpm, the supernatant was isolated, and protein levels were assayed by the Bradford method (2) for each sample. Fifty micrograms of each sample were loaded and run on 12% SDS-PAGE gels, transferred to supported nitrocellulose membranes, and subsequently exposed to primary and secondary antibodies in 5% milk + Tris-buffered saline-Tween buffers and detected by ECL on autoradiography film. Densitometry analysis was used to quantitate protein levels, and protein content was expressed as spot density. Nox1, Nox2, and Nox4, and G6PD antibodies were from Santa Cruz (Santa Cruz, CA) and Sigma-RBI, respectively, and secondary anti-rabbit and anti-mouse antibodies were from Sigma-RBI.

Statistical analysis. Chemiluminescence, pyridine nucleotide, mRNA, and Western blot data were analyzed by Student's t-tests. A Bonferroni correction was used when multiple comparisons were made. The acceptable level of significance was P < 0.05. The number of experimental determinations (n) in all cases is equal to the animals from which an arterial ring was employed for a treatment or a control group in all studies. Values are means ± SE.


   RESULTS
TOP
 ABSTRACT
 MATERIALS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Superoxide levels detected by lucigenin chemiluminescence in BCA and BPA. Detection of O2– levels using lucigenin (5 µM) chemiluminescence revealed that BPA rings generated ~60–80% higher basal O2– level compared with BCA (Fig. 1), This was further confirmed by a treatment of BPA with O2– scavengers polyethylene glycol (PEG)-SOD (137 U/ml) and tiron (10 mM), which inhibited O2– by 60% and 82%, respectively. Treatment of BCA with similar concentrations of PEG-SOD and tiron suppressed O2– levels by 80% and 93%, respectively. Because of the markedly greater amount of vascular smooth muscle cells compared with other cells present in the adventitia of the endothelium-removed conduit-sized arteries studied, the levels of O2– detected by lucigenin are interpreted as representing primarily the contribution of this cell type.



View larger version (21K):
[in this window]
[in a new window]
  		Fig. 1. Comparison of basal levels of lucigenin-detectable superoxide (O2–) in bovine pulmonary and coronary arteries. Bovine pulmonary artery (BPA, n = 10) and bovine coronary artery (BCA, n = 15) rings were incubated at 37°C for 1 h, and O2– was estimated by lucigenin (5 µM) chemiluminescence (A). The O2– scavenger PEG-SOD (137 U/ml) and tiron (10 mM) inhibited O2– in BPA (B; n = 5) and BCA (C; n = 5).

 
Determination of the influence of Nox oxidase activation and pentose phosphate pathway NADPH on O2– in BCA and BPA. To determine whether Nox activation by binding its p47phox subunit was influencing the source of O2– that may contribute to the higher levels observed in BPA, we tested the effect of apocynin (10 µM), an NAD(P)H oxidase inhibitor, on the O2– levels from BPA and BCA. Our data in Fig. 2 indicated that apocynin suppressed the O2– levels by 51% and 37% in BPA and BCA, respectively. In contrast, stimulation of NAD(P)H oxidase activity by activating protein kinase C with phorbol-12,13-dibutyrate to promote p47phox phosphorylation and binding to Nox2 (12) significantly increased O2– levels in both BCA and BPA. The increase in lucigenin chemiluminescence was more than 15-fold in BPA and 5-fold in BCA, and this resulted in BPA showing 5-fold greater levels of O2– than BCA. Furthermore, to investigate whether PPP-derived NADPH influences NAD(P)H oxidase activity in BCA and BPA, the effect of 6-aminonicotinamide (6-AN) (1 mM), a probe previously used by us to inhibit this pathway (6), was studied for its influence on O2– levels in these arterial segments (Fig. 2). A dose of 1 mM 6-AN was selected for use based on observations that it lowered NADPH by 50–70% in BCA and rat lungs (6, 8). 6-AN inhibited basal O2– levels by 75% in BPA, and it decreased O2– levels by only 40% in BCA.



View larger version (22K):
[in this window]
[in a new window]
  		Fig. 2. Effects of inhibition of the activity of the pentose phosphate pathway (PPP) and Nox activation on BPA and BCA O2– levels. Lucigenin-detectable O2– in both BPA (A) and BCA (B) were suppressed by 6-aminonicotinamide (6-AN; n = 10–15) and apocynin (Apo; n = 5–10). However, O2– was markedly elevated in the BPA and BCA by phorbol-12,13-dibutyrate (PDBu; n = 6–10) stimulation of NAD(P)H oxidase activity.

 
Evaluation of the NADH and NADPH dependence of O2– generation in BPA and BCA homogenates and isolated microsomes. To compare the influence of NADPH and NADH on O2– generation in BPA and BCA, the concentration dependence of O2– generation by these pyridine nucleotides was evaluated in BPA and BCA homogenates (see Fig. 3). In the BPA homogenate, NADPH (0.1–1,000 µM) and NADH (0.1–1,000 µM) increased O2– generation in a concentration-dependent manner. However, at higher concentrations NADH (100 and 1,000 µM) promoted significantly more O2– generation than NADPH. Nevertheless, at more physiologically relevant lower concentrations (e.g., 1–10 µM), NADPH generated significantly higher O2– (see Fig. 3, inset) than NADH. Although in BCA both NADPH and NADH elevated O2– levels in a concentration-dependent manner, there was no difference in the generation of O2– at each concentration of NADH and NADPH examined (Fig. 3). In the microsomal membrane fraction of BPA, although a distinct NADPH-dependent production of O2– was observed at the 100 µM concentration examined, 100 µM NADH resulted in a markedly greater level of O2– generation. A similar pattern of NADH and NADPH-dependent O2– production was observed in the microsomal membrane fraction obtained from BCA.



View larger version (38K):
[in this window]
[in a new window]
  		Fig. 3. NADPH and NADH concentration dependence of O2– generation in homogenates and microsomes from BPA and BCA. NADPH (n = 5) and NADH (n = 5) increased O2– in BPA (top left) and BCA homogenates (top right) in a dose-dependent manner. Higher levels of O2– production were observed by more physiological concentrations of NADPH (0.1–10 µM) compared with NADH in BPA but not in BCA (inset). In microsomes obtained after 100,000 g centrifugation, NADH (n = 5) produced more O2– than NADPH (n = 5) in BPA (bottom left) and BCA (bottom right).

 
Identification mRNA for Nox2 and Nox4 by QRT-PCR in BCA and BPA. It has been reported that three of the isoforms of NAD(P)H oxidases, namely Nox1, Nox2, and Nox4, are expressed in the cultured vascular smooth muscle cells and/or intact arteries (5, 10, 26), but a comparison of the expression of these oxidases between a pulmonary and systemic artery has not been previously reported. Hence, QRT-PCR for Nox1, Nox2, and Nox-4 was performed to determine the source of O2– in BPA and BCA. Although the message for Nox1 could not be detected by using several different primers designed from human and animal sequences, mRNA for both Nox2 and Nox4 were observed to be present in BPA and BCA in levels that appeared to be similar to each other (see Fig. 4).



View larger version (38K):
[in this window]
[in a new window]
  		Fig. 4. Estimation of the expression of Nox2 and Nox4 by QRT-PCR and Western blot analysis. The mRNA for NAD(P)H oxidases Nox2 and Nox4 was quantitated (n = 6) in the BPA and BCA by QRT-PCR and normalized by {alpha}-actin (top). Representative data of Western blot analysis (n = 12) for both the oxidases in BPA (lanes 1–4) and BCA (lanes 5–8) (middle), and summary of densitometry of Nox2 (bottom left; 65 kDa) and Nox4 (bottom right; 80 kDa) protein in BPA and BCA are shown together with a HL-60 whole cell lysate (Santa Cruz; SC-2209), which was used as a positive control in Western blot studies.

 
Identification and expression of Nox2 and Nox4 protein by Western blot analysis. The levels of expression of Nox2 and Nox4 in BPA were compared with the levels observed in BCA by Western blot analysis (see Fig. 4). SDS gel electrophoresis was performed with BPA and BCA samples to detect Nox1, Nox2, and Nox4. Our results suggest that several bands were detected with the Nox2 antibody used, with one of the bands at ~65 kDa, which was similar to that reported in rat and mouse models (1, 13, 14). In addition, we have detected additional bands at ~120 and 50 kDa, which remain to be identified. Western blot analysis for Nox4 protein showed two bands around 80 and 65 kDa, and this is consistent with previous reports detecting bands of similar molecular mass (3, 10). An additional band at ~70 kDa that remains to be identified was also detected in BCA. After each blot was analyzed for Nox protein expression, each blot was stripped and reprobed for the detection of {alpha}-actin protein levels to confirm uniform loading (not shown). The densitometry analysis demonstrated in Fig. 4 indicates that BPA and BCA had similar levels of both Nox2 and Nox4 based on an analysis of the protein bands we could identify (65 and 80 kDa) as originating from these Nox oxidases. Nox1 could not be detected under similar conditions.

Measurement of NADP(H), NAD(H), and ATP levels in BCA and BPA. Pyridine nucleotide levels in BPA and BCA were determined by HPLC. As shown in Fig. 5, we found fourfold more NADPH levels in BPA compared with BCA. A similar difference was found in NADP+ levels. The NADP+-to-NADPH ratio in BPA was 1.3 and in BCA was 0.6. Although we could not distinguish between cytosolic or mitochondrial NAD(H), total NADH levels estimated in BCA homogenate were higher than BPA. In contrast, NAD+ levels were approximately fourfold higher in BPA. Additionally, the NAD+-to-NADH ratio in BPA was 16.0 and in BCA was 1.8. ATP levels were about twofold higher in BCA, even though there were no differences in O2 consumption levels between BCA and BPA (Fig. 5, E and F).



View larger version (43K):
[in this window]
[in a new window]
  		Fig. 5. Comparisons of the levels of pyridine nucleotides, ATP, and respiration levels observed in BPA and BCA. The pyridine nucleotide were separated and quantitated in BPA (n = 15) and BCA (n = 20) by HPLC. Differences in the NADPH (top left), NADP+ (top right), NADH (middle left), and NAD+ (middle right) in BPA vs. BCA are shown. ATP levels (bottom left) were also significantly lower in BPA. There were no difference were found in the O2 consumption (bottom right) between BPA and BCA.

 
Determination of G6PD activity and expression and G6P levels in BCA and BPA. To investigate the underlying cause for higher NADPH levels in BPA, we estimated the activity of G6PD, which is a rate-limiting enzyme in PPP, and G6P levels in coronary and pulmonary artery. Estimation of G6P levels indicated that BPA has 59% lower G6P content (Fig. 6). Our results indicated that BPA has 1.6-fold higher G6PD activity than estimated in BCA (Fig. 6). Furthermore, the PPP inhibitor 6-AN (1 mM) attenuated G6PD activity in homogenates of BPA and BCA by 55% and 52%, respectively. Western blot analyses were also consistent with G6PD levels being elevated in BPA probably as a result of a higher expression of G6PD protein (Fig. 7).



View larger version (76K):
[in this window]
[in a new window]
  		Fig. 6. Comparisons of the levels glucose-6-phosphate (G6P) and glucose-6-phosphate dehydrogenase (G6PH) in BPA and BCA. Estimation of G6P in the BPA (n = 10) and BCA (n = 15) indicate significant lower G6P levels in BPA (top left). Whereas G6PD activity was higher in BPA (n = 20) compared with BCA (n = 25), moreover G6PD activity was significantly reduced by 6-AN (bottom; n = 10–15).

 


View larger version (43K):
[in this window]
[in a new window]
  		Fig. 7. Comparisons of the expression of G6PD in BPA and BCA. A differential expression of G6PD protein was seen in the pulmonary and coronary arteries (top). Cumulative data of G6PD Western blot analysis in BPA (n = 9) and BCA (n = 9) demonstrate a significantly higher G6PD protein in BPA.

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
O2– generation in both BPA and BCA appear to originate from Nox-type NAD(P)H oxidases based on data from previous studies (16–20, 22) in these arteries and the results of the present study. Whereas our earlier studies detected a much greater level of NADH than NADPH-dependent O2– generation employing larger lucigenin concentrations, when examined at lower levels of lucigenin that are thought to be free of redox cycling artifacts, NADPH oxidase activity was nearly as prominent as NADH oxidase activity in artery homogenates, especially at concentrations of NAD(P)H that are thought to be physiologically relevant. Cytosolic NAD(H) is thought to be highly oxidized as a result of the lactate dehydrogenase reaction and function of mitochondrial shuttles for NADH removal (24). Thus it is likely that basal levels of cytosolic NADH are likely to be in the concentration range of 1 µM (28), and most of the NADH that was measured probably originates from mitochondrial sources. The function of the PPP appears to control the redox status of NADP(H) in the bovine arteries examined (6), and cytosolic NADPH levels are likely to be in the range of 10–20 µM based on the measurements made in the present study. This estimate of cytosolic NADPH concentrations is based on comparisons with the tissue levels of other well-characterized metabolites such as ATP and glutathione and based on the assumption that mitochondria are only a relatively minor contributor to the levels that were measured. Thus based on the NADH and NADPH concentration dependence of O2– generation in BPA and BCA homogenates observed in the present study and estimates of the cytosolic levels of these metabolites that are likely to be present in these arteries, cytosolic NADPH may be a more important source of O2– generation than NADH under the basal conditions examined in the present study. The effects of PPP inhibition with 6-AN on the levels of detected O2– support these interpretations because lowering cytosolic NADPH levels by inhibiting the PPP decreased O2– detection. Our previous studies suggest that attempting to further lower cytosolic NADH through the lactate dehydrogenase reaction with pyruvate did not alter basal O2–; however, lactate raised the levels of O2– detected in the arteries studied (9, 17, 18, 23), suggesting that basal O2– generation is regulated by increases in cytosolic NADH levels.

The Nox oxidases present in BPA and BCA appear to be Nox2 and Nox4. Nox1 could not be detected in BCA and BPA. Nox2 is the phagocytic cell gp91phox-type oxidase. Whereas the gp91phox system in phagocytes has an apparent 91-kDa molecular mass due to glycosylation, the antibody used in the present study, which is selective for unique amino acid sequences on this subunit, detected proteins with molecular masses in the range of 50–65 and 120 kDa. It is likely that the protein subunits observed with the Nox2 antibody originate from differences in glycosylation and perhaps regulation through other forms of covalent bond modification in BPA and BCA. However, nonspecific binding artifacts with BPA and BCA proteins cannot be ruled out as a source of novel bands such as the protein observed at 120 kDa because of the limited amount of studies that have been conducted with the antibody employed in the present study. In other studies, antibodies for Nox2 have detected 65-, 75-, and 110-kDa proteins (1, 13, 14). The Nox4 antibody detected proteins with molecular masses in the region of 65 and 80 kDa, which are in the range of previously reported Nox4 subunits (3, 10). The source of the additional band at 50 kDa, and the new band at ~70 kDa observed only in BCA are not known at this time. Further investigation is needed to determine whether the additional molecular mass bands observed are artifacts of the properties of the antibody used or if they originate from novel properties of the Nox oxidase subunits expressed in BPA and BCA. Based on the QRT-PCR, Western blot analyses, and the properties of O2– generation by oxidase activities present at physiological levels of NAD(P)H, there appear to be similar levels of Nox oxidase activity in BPA and BCA. Whereas little is known about the individual contributions of Nox2 and Nox4 containing oxidase systems to the basal levels of O2– that were detected, it is likely that the actions of apocynin originate from a selective inhibition of Nox2, because Nox4 does not appear to be regulated by binding of its p47phox subunit (12).

The function of the PPP in controlling cytosolic NADPH levels may be an important factor controlling the observed elevation of basal O2– levels BPA compared with BCA. Although BCA contained higher levels of NADH than BPA, it is likely that this reflects a property of basal mitochondrial function such as the maintenance of higher ATP levels in BCA and not a mechanism directly controlling O2– levels, because most of the NADH detected is likely to be present in mitochondria. In addition, basal oxygen consumption rates were similar in BCA and BPA, and this suggests that the differences in NADH and ATP levels observed in these arteries are metabolic adaptations that are not likely to originate from factors that control mitochondrial respiration or basal levels of energy consumption. Because BPA were observed to have higher levels of G6PD expression and activity, it is likely that the known function of this enzyme as the rate-limiting step of the PPP is a primary factor in the observed higher levels of NADPH in these arteries compared with BCA. Based on the potential importance of cytosolic NADPH levels controlling basal O2– production, the increased activity of the PPP in BPA may be a primary factor in the generating the increased levels of O2– observed in these arteries compared with BCA.

Observations made in this study suggest that the levels of both cytosolic NADH and NADPH are important factors influencing the Nox oxidase activity present in BPA and BCA. In previous studies, we have shown that modulating cytosolic NADH levels through the lactate dehydrogenase reaction influences responses to hypoxia-reoxygenation (23) and NO (9) potentially mediated through cGMP by alterations in the levels of hydrogen peroxide and superoxide, respectively, suggesting that basal levels of cytosolic NADH have an important role in controlling the signaling mechanisms linked to these responses. In contrast, lowering basal levels of NADPH by inhibiting the PPP decreased the levels of superoxide in both BCA and BPA, and this appears to be associated with the activation of a coordination of processes that lower intracellular calcium in a manner that appears to be independent of Nox oxidase-derived oxidant species (6). Cytosolic NADPH-dependent systems seem designed to work in a manner that coordinate the control of both Nox activity generating reactive oxygen species (ROS) and the impact of ROS on thiol redox signaling through the influence of NADPH availability on the activities of Nox oxidases and NADPH-dependent thiol-reducing systems, including glutathione reductase and thioredoxin reductase. The higher levels of G6PD and NADPH in pulmonary arteries should also increase their resistance to other sources of oxidative stress compared with coronary arteries. Fundamental differences exist between the response of BPA and BCA to hypoxia, with BPA contracting to hypoxia through processes that appear to originate from a lowering of basal peroxide levels (21), and BCA relaxing through a mechanism associated with lowering basal levels of NADPH (7, 8). The observed differences in control of cytosolic NADPH by the PPP between BCA and BPA may be a key factor in generating the differences in responses to hypoxia that are observed with BPA maintaining a higher basal level of Nox-derived peroxide as a result of the higher levels of NADPH present in these arteries and with hypoxia lowering NADPH in BCA as a result of the less effective ability of the PPP to compete with glycolysis potentially originating from the lower levels of G6P that are present in these vessels during hypoxia. Because mice lacking Nox2 (gp91phox) show a normal response to hypoxia in a model also thought to involve a hypoxia-mediated decrease in peroxide (1), the Nox4 observed to be present in BPA may be the oxygen sensor involved in the pulmonary response to hypoxia.


   GRANTS
TOP
 ABSTRACT
 MATERIALS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This study was supported by National Heart, Lung, and Blood Institute Grants HL-66331, HL-31069, HL-46813, and HL-43023.


   ACKNOWLEDGMENTS
 
We appreciate technical help from Vijay Munduri for detecting G6PD and Aracelie Rivera for performing QRT-PCR.


   FOOTNOTES
 

Address for reprint requests and other correspondence: M. S. Wolin, Dept. of Physiology, Basic Sciences Bldg., New York Medical College, Valhalla, NY 10595 (E-mail: mike_wolin{at}nymc.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Archer SL, Reeve HL, Michelakis E, Puttagunta L, Waite R, Nelson DP, Dinauer MC, and Weir EK. O2 sensing is preserved in mice lacking the gp91 phox subunit of NADPH oxidase. Proc Natl Acad Sci USA 96: 7944–7949, 1999.[Abstract/Free Full Text]
  2. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254, 1976.[CrossRef][ISI][Medline]
  3. Byrne JA, Grieve DJ, Bendall JK, Li JM, Gove C, Lambeth JD, Cave AC, and Shah AM. Contrasting roles of NADPH oxidase isoforms in pressure-overload versus angiotensin II-induced cardiac hypertrophy. Circ Res 93: 802–805, 2003.[Abstract/Free Full Text]
  4. Csiszar A, Ungvari Z, Edwards JG, Kaminski P, Wolin MS, Koller A, and Kaley G. Aging-induced phenotypic changes and oxidative stress impair coronary arteriolar function. Circ Res 90: 1159–1166, 2002.[Abstract/Free Full Text]
  5. Griendling KK, Sorescu D, and Ushio-Fukai M. NAD(P)H oxidase: role in cardiovascular biology and disease. Circ Res 86: 494–501, 2000.[Abstract/Free Full Text]
  6. Gupte SA, Arshad M, Viola S, Kaminski PM, Ungvari Z, Rabbani G, Koller A, and Wolin MS. Pentose phosphate pathway coordinates multiple redox-controlled relaxing mechanisms in bovine coronary arteries. Am J Physiol Heart Circ Physiol 285: H2316–H2326, 2003.[Abstract/Free Full Text]
  7. Gupte SA, Li KX, Okada T, Sato K, and Oka M. Inhibitors of pentose phosphate pathway cause vasodilation: involvement of voltage-gated potassium channels. J Pharmacol Exp Ther 301: 299–305, 2002.[Abstract/Free Full Text]
  8. Gupte SA, Rabbani G, Arshad M, and Wolin MS. Changes in the NADPH and glutathione redox mediate bovine coronary artery relaxation to hypoxia. Circulation 106: II-495, 2002.
  9. Gupte SA, Rupawalla T, Mohazzab-H KM, and Wolin MS. Regulation of NO-elicited pulmonary artery relaxation and guanylate cyclase activation by NADH oxidase and SOD. Am J Physiol Heart Circ Physiol 276: H1535–H1542, 1999.[Abstract/Free Full Text]
  10. Hilenski LL, Clempus RE, Quinn MT, Lambeth JD, and Griendling KK. Distinct subcellular localizations of Nox1 and Nox4 in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol 24: 677–683, 2004.[Abstract/Free Full Text]
  11. Jungling E, Timmerman M, Ionescu AA, Mertens M, Loken C, Kammermeier H, and Fischer Y. Luminometric measurement of subnanomole amounts of key metabolites in extracts from isolated heart muscle cells. Anal Biochem 239: 41–46, 1996.[CrossRef][ISI][Medline]
  12. Lambeth JD. NOX enzymes and the biology of reactive oxygen. Nat Rev Immunol 4: 181–189, 2004.[CrossRef][ISI][Medline]
  13. Li JM, Gall NP, Grieve DJ, Chen M, and Shah AM. Activation of NADPH oxidase during progression of cardiac hypertrophy to failure. Hypertension 40: 477–484, 2002.[Abstract/Free Full Text]
  14. MacCarthy PA, Grieve DJ, Li JM, Dunster C, Kelly FJ, and Shah AM. Impaired endothelial regulation of ventricular relaxation in cardiac hypertrophy: role of reactive oxygen species and NADPH oxidase. Circulation 104: 2967–2974, 2001.[Abstract/Free Full Text]
  15. Miller FJ and Griendling KK. Functional evaluation of nonphagocytic NAD(P)H oxidases. Methods Enzymol 353: 220–233, 2002.[ISI][Medline]
  16. Mohazzab-H KM, Agarwal R, and Wolin MS. Influence of glutathione peroxidase on coronary artery responses to alterations in PO2 and H2O2. Am J Physiol Heart Circ Physiol 276: H235–H241, 1999.[Abstract/Free Full Text]
  17. Mohazzab-H KM, Fayngersh RP, Kaminski PM, and Wolin MS. Potential role of NADH oxidoreductase-derived reactive O2 species in calf pulmonary arterial PO2-elicited responses. Am J Physiol Lung Cell Mol Physiol 269: L637–L644, 1995.[Abstract/Free Full Text]
  18. Mohazzab-H KM, Kaminski PM, Fayngersh RP, and Wolin MS. Oxygen-elicited responses in calf coronary arteries: role of H2O2 production via NADH-derived superoxide. Am J Physiol Heart Circ Physiol 270: H1044–H1053, 1996.[Abstract/Free Full Text]
  19. Mohazzab-H KM and Wolin MS. Sites of superoxide anion production detected by lucigenin in calf pulmonary artery smooth muscle. Am J Physiol Lung Cell Mol Physiol 267: L815–L822, 1994.[Abstract/Free Full Text]
  20. Mohazzab-H K, and Wolin MS. Properties of a superoxide anion-generating microsomal NADH oxidoreductase, a potential pulmonary artery PO2 sensor. Am J Physiol Lung Cell Mol Physiol 267: L823–L831, 1994.[Abstract/Free Full Text]
  21. Monaco JA and Burke-Wolin T. NO and H2O2 mechanisms of guanylate cyclase activation in oxygen-dependent responses of rat pulmonary circulation. Am J Lung Cell Molec Physiol 268: L546–L550, 1995.
  22. Oeckler RA, Kaminski PM, and Wolin MS. Stretch enhances contraction of bovine coronary arteries via an NAD(P)H oxidase-mediated activation of the extracellular signal-regulated kinase mitogen-activated protein kinase cascade. Circ Res 92: 23–31, 2003.[Abstract/Free Full Text]
  23. Omar HA, Mohazzab-H KM, Mortelliti MP, and Wolin MS. O2-dependent modulation of calf pulmonary artery tone by lactate: potential role of H2O2 and cGMP. Am J Physiol Lung Cell Mol Physiol 264: L141–L145, 1993.[Abstract/Free Full Text]
  24. Rabinowitz JD, Vacchino JF, Beeson C, and McConnell HM. Potentiometic measurement of intracellular redox activity. J Am Chem Soc 120: 2464–4250, 1998.[CrossRef]
  25. Sorescu D, Somers MJ, Lassegue B, Grant S, Harrison DG, and Griendling KK. Electron spin resonance characterization of the NAD(P)H oxidase in vascular smooth muscle cells. Free Radic Biol Med 30: 603–612, 2001.[CrossRef][ISI][Medline]
  26. Sorescu D, Weiss D, Lassegue B, Clempus RE, Szocs K, Sorescu GP, Valppu L, Quinn MT, Lambeth JD, Vega JD, Taylor WR, and Griendling KK. Superoxide production and expression of nox family proteins in human atherosclerosis. Circulation 105: 1429–1435, 2002.[Abstract/Free Full Text]
  27. Stanton RC, Seifter JL, Boxer DC, Zimmerman E, and Cantley LC. Rapid release of bound glucose-6-phosphate dehydrogenase by growth factors. Correlation with increased enzymatic activity. J Biol Chem 266: 12442–12448, 1991.[Abstract/Free Full Text]
  28. Wolin MS, Burke-Wolin TM, Kaminski PM, and Mohazzab-H KM. Reactive oxygen species and vascular oxygen sensors. In: Nitric Oxide and Radicals in the Pulmonary Vasculature, edited by Weir AS, Reeves EK, and Armonk JT. New York: Futura, 1996, p. 245–263.



This article has been cited by other articles:


Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
Q. Gao and M. S. Wolin
Effects of hypoxia on relationships between cytosolic and mitochondrial NAD(P)H redox and superoxide generation in coronary arterial smooth muscle
Am J Physiol Heart Circ Physiol, September 1, 2008; 295(3): H978 - H989.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
A. Csiszar, N. Labinskyy, H. Jo, P. Ballabh, and Z. Ungvari
Differential proinflammatory and prooxidant effects of bone morphogenetic protein-4 in coronary and pulmonary arterial endothelial cells
Am J Physiol Heart Circ Physiol, August 1, 2008; 295(2): H569 - H577.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
M. Li, D. H. Kim, P. L. Tsenovoy, S. J. Peterson, R. Rezzani, L. F. Rodella, W. S. Aronow, S. Ikehara, and N. G. Abraham
Treatment of Obese Diabetic Mice With a Heme Oxygenase Inducer Reduces Visceral and Subcutaneous Adiposity, Increases Adiponectin Levels, and Improves Insulin Sensitivity and Glucose Tolerance
Diabetes, June 1, 2008; 57(6): 1526 - 1535.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Huang, P. M. Kaminski, J. G. Edwards, A. Yeh, M. S. Wolin, W. H. Frishman, M. H. Gewitz, and R. Mathew
Pyrrolidine dithiocarbamate restores endothelial cell membrane integrity and attenuates monocrotaline-induced pulmonary artery hypertension
Am J Physiol Lung Cell Mol Physiol, June 1, 2008; 294(6): L1250 - L1259.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. Medhora, Y. Chen, S. Gruenloh, D. Harland, S. Bodiga, J. Zielonka, D. Gebremedhin, Y. Gao, J. R. Falck, S. Anjaiah, et al.
20-HETE increases superoxide production and activates NAPDH oxidase in pulmonary artery endothelial cells
Am J Physiol Lung Cell Mol Physiol, May 1, 2008; 294(5): L902 - L911.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
A. L. Moens, H. C. Champion, M. J. Claeys, B. Tavazzi, P. M. Kaminski, M. S. Wolin, D. J. Borgonjon, L. Van Nassauw, A. Haile, M. Zviman, et al.
High-Dose Folic Acid Pretreatment Blunts Cardiac Dysfunction During Ischemia Coupled to Maintenance of High-Energy Phosphates and Reduces Postreperfusion Injury
Circulation, April 8, 2008; 117(14): 1810 - 1819.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
C. J. Mingone, M. Ahmad, S. A. Gupte, J. L. Chow, and M. S. Wolin
Heme oxygenase-1 induction depletes heme and attenuates pulmonary artery relaxation and guanylate cyclase activation by nitric oxide
Am J Physiol Heart Circ Physiol, March 1, 2008; 294(3): H1244 - H1250.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
S. L. Archer, M. Gomberg-Maitland, M. L. Maitland, S. Rich, J. G. N. Garcia, and E. K. Weir
Mitochondrial metabolism, redox signaling, and fusion: a mitochondria-ROS-HIF-1{alpha}-Kv1.5 O2-sensing pathway at the intersection of pulmonary hypertension and cancer
Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H570 - H578.
[Abstract] [Full Text] [PDF]

Home page
 Exp PhysiolHome page
D. Hodyc, M. Snorek, T. Brtnicky, and J. Herget
Respiratory: Superoxide dismutase mimetic tempol inhibits hypoxic pulmonary vasoconstriction in rats independently of nitric oxide production
Exp Physiol, September 1, 2007; 92(5): 945 - 951.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
G. Zhang, F. Zhang, R. Muh, F. Yi, K. Chalupsky, H. Cai, and P.-L. Li
Autocrine/paracrine pattern of superoxide production through NAD(P)H oxidase in coronary arterial myocytes
Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H483 - H495.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
B. T. Larsen and D. D. Gutterman
Hypoxia, coronary dilation, and the pentose phosphate pathway
Am J Physiol Heart Circ Physiol, June 1, 2006; 290(6): H2169 - H2171.
[Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
S. A. Gupte and M. S. Wolin
Hypoxia promotes relaxation of bovine coronary arteries through lowering cytosolic NADPH
Am J Physiol Heart Circ Physiol, June 1, 2006; 290(6): H2228 - H2238.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. S. Wolin, M. Ahmad, and S. A. Gupte
Oxidant and redox signaling in vascular oxygen sensing mechanisms: basic concepts, current controversies, and potential importance of cytosolic NADPH
Am J Physiol Lung Cell Mol Physiol, August 1, 2005; 289(2): L159 - L173.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
S. Turkseven, A. Kruger, C. J. Mingone, P. Kaminski, M. Inaba, L. F. Rodella, S. Ikehara, M. S. Wolin, and N. G. Abraham
Antioxidant mechanism of heme oxygenase-1 involves an increase in superoxide dismutase and catalase in experimental diabetes
Am J Physiol Heart Circ Physiol, August 1, 2005; 289(2): H701 - H707.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
S. Kinugawa, J. Zhang, E. Messina, E. Walsh, H. Huang, P. M. Kaminski, M. S. Wolin, and T. H. Hintze
gp91phox-containing NAD(P)H oxidase mediates attenuation of nitric oxide-dependent control of myocardial oxygen consumption by ANG II
Am J Physiol Heart Circ Physiol, August 1, 2005; 289(2): H862 - H867.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
C. S. Wilcox and D. Gutterman
Focus on oxidative stress in the cardiovascular and renal systems
Am J Physiol Heart Circ Physiol, January 1, 2005; 288(1): H3 - H6.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
288/1/H13    most recent
00629.2004v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gupte, S. A.
Right arrow Articles by Wolin, M. S.
Right arrow Search for Related Content