Vol. 273, Issue 5, H2119-H2127, November 1997
A role for neuropeptide Y in rat iridial arterioles
Matthew J.
Newhouse and
Caryl E.
Hill
Division of Neuroscience, John Curtin School of Medical
Research, Australian National University, Canberra, Australian
Capital Territory 0200, Australia
 |
ABSTRACT |
A role for
neuropeptide Y (NPY) in neurotransmission in rat iridial arterioles has
been investigated. Reverse transcription-polymerase chain reaction
analysis has demonstrated mRNA expression for both Y1 and
Y2 receptors in the superior
cervical ganglion and iris. The Y1
agonist
[Leu31,Pro34]NPY
caused a dose-dependent constriction of iris arterioles (50% effective
concentration of 10
8 M),
but, at low concentrations
(109 and
1010 M), it failed to
potentiate either submaximal responses to norepinephrine (106 M) or submaximal,
noradrenergic responses to nerve stimulation. In contrast,
107 M
[Leu31,Pro34]NPY
potentiated submaximal, noradrenergic responses to nerve stimulation
(10 Hz, 
1 s) and to a concentration of norepinephrine (107 M) which produced only
small contractions. The Y1
antagonist 1229U91 blocked contractions induced by
[Leu31,Pro34]NPY.
Stimulation of the nerves for longer periods (10 or 20 Hz; 5, 30, or 60 s) revealed a component of the response which was reduced by 1229U91.
This component was not apparent after brief stimuli (10 Hz, 1 s),
even when opposing receptor pathways were blocked. The
Y2 agonist
N-acetyl-[Leu28,Leu31]NPY24-36
had little effect on arterioles preconstricted with either high potassium or an 
2-adrenoceptor
agonist, or on nerve-mediated contractions. Results suggest that NPY,
released from sympathetic nerves during long-duration, high-frequency
stimulation, activates Y1
receptors on iris arterioles to produce vasoconstriction and to
potentiate responses to low concentrations of norepinephrine.
receptors; reverse transcriptase-polymerase chain reaction; vasoconstriction; potentiation
| |
INTRODUCTION |
NEUROPEPTIDE Y (NPY) is a 36-amino acid peptide that
has been implicated in numerous physiological processes, including
thirst, appetite, and control of blood pressure (see Ref. 29). In the peripheral nervous system, NPY is found in both sympathetic ganglia, where it is manufactured, and sympathetic nerve terminals (see Ref. 29). In the latter, it is co-released with
norepinephrine (NE) and ATP to control smooth muscle tone (31; see
also Ref. 29). In general, NPY serves to improve the economy of the
sympathetic nerve-mediated response by complementing and potentiating
the effects of NE or ATP (31, 37; see also Ref. 29) and by reducing the
effect of vasodilatory neurotransmitter released from sensory (16) or
cholinergic (19) nerves. NPY also inhibits release from sympathetic
nerves (24, 34).
Of the proposed NPY receptor subtypes, those with most relevance for
vascular smooth muscle have been designated
Y1 and
Y2 (11).
Y1 receptors are thought to be
postsynaptic (37), inducing a strong vasoconstriction of many vessels
(11, 24). They are coupled to inhibition of adenylate cyclase via a
Gi protein (2, 7, 13).
Subsequently, intracellular calcium levels are raised after
mobilization from intracellular stores (5) and influx of extracellular
calcium (6, 32). Y2 receptors are
considered to be predominantly presynaptic (19, 30). They have been
linked to inhibition of calcium influx into nerve terminals through
N-type voltage-dependent channels (34). However, there is also evidence for the existence of postsynaptic
Y2 receptors (24, 26, 33) and
presynaptic Y1 receptors (24) in
some vessels.
Previous experiments in this laboratory (10) have shown that, in rat
iris arterioles, the nerve-mediated contractile response to short
stimuli at 10 Hz results from the activation of
1B-adrenoceptors by NE.
However, NPY is also present in the sympathetic nerves around the iris
arterioles (28), and in guinea pig ear arterioles there is a good
correlation between localization of NPY in sympathetic terminals and a
response to exogenous NPY (25). This suggests that NPY receptors should
be present in the rat iris arterioles. The failure to observe an NPY
effect may be due to a number of factors. NPY may be released in
quantities that do not produce a postsynaptic response but that
potentiate responses to NE. Alternatively, there may be a masking of
NPY effects due to the simultaneous activation of other postsynaptic
receptors, such as 
-adrenoceptors or calcitonin gene-related peptide
(CGRP) receptors, which might activate opposing signal transduction
pathways (35). Finally, the absence of NPY effects may
result from the fact that the stimulation parameters used are not
conducive to NPY release. Synaptic vesicles storing NPY appear to
require larger or more sustained stimuli to be released (18, 23).
In the present study, we have looked for expression of mRNA for the
Y1 and
Y2 receptors in the iris and in
the superior cervical ganglion (SCG), the source of the sympathetic
nerve fibers to the iris, using reverse transcriptase-polymerase chain
reaction (RT-PCR) and subtype-specific primers. Protein expression has been studied using agonists specific for the two NPY receptors, [Leu31,Pro34]NPY
(8) for Y1 receptors and
N-acetyl-[Leu28,Leu31]NPY24-36
(30) for Y2 receptors. The
possibility of NPY involvement in nerve-mediated responses has been
studied under conditions in which potentiation by NPY of noradrenergic
responses may be uncovered, in which potentially competing receptors
were blocked, and also under different stimulus conditions.
| |
MATERIALS AND METHODS |
Dissection and sample preparation.
Wistar rats of either sex (4-6 wk) were killed with an overdose of
ether anesthetic, and the eyes were removed into Krebs solution
containing (in mM) 119.8 NaCl, 5.0 KCl, 2.5 CaCl2, 2.0 MgCl2, 1.0 NaH2PO4,
25 NaHCO3, and 27.8 glucose, which
was gassed with 5% CO2-95%
O2. Scopolamine
(106 M) was added to the
working Krebs solution in all experiments to eliminate the effect of
cholinergic nerves. Antagonists against nicotinic or vasoactive
intestinal peptide receptors were not used because these receptors do
not appear to play a significant role in this tissue (14,
28). The irides were removed and cut in half. Each half,
containing two intact arterioles, was pinned flat using tungsten wire
pins along the corneal edge and through the sphincter muscle.
Transmural stimuli were delivered using two platinum wire electrodes
inserted on opposite sides of the preparation.
Drugs and solutions.
The following drugs were used: scopolamine hydrochloride, benextramine
tetrahydrochloride, tetrodotoxin, and
l-arterenol bitartrate (NE) from Sigma
(St. Louis, MO); propranolol hydrochloride from ICN (Costa Mesa, CA);
capsaicin from Fluka Chemie (Buchs, Switzerland); 1229U91 [NPY
Y1-receptor antagonist
(20)], kindly supplied by J. Angus and R. Murphy, Melbourne
University (Parkville, Victoria, Australia);
[Leu31,Pro34]NPY
(human) (NPY Y1-receptor agonist)
and
N-acetyl-[Leu28,Leu31]NPY24-36
amide (NPY Y2-receptor agonist)
from Auspep, Parkville, Victoria, Australia; and
UK-14304-18 and prazosin from Pfizer Central Research (Sandwich,
England). Stock solutions of 1,000- to 10,000-fold the working
dilutions were dissolved in water, except for the stock solutions of
capsaicin (ethanol), prazosin (20% methanol), and NE and UK-14304-18
(2% ascorbic acid). Control experiments did not show any effects of
these diluents. Krebs solution containing 30 mM potassium was made by
substituting the required molar amount of NaCl with KCl.
Experimental protocol.
Preparations were equilibrated in Krebs solution for 30 min
(31-33°C) before nerve stimulations (10 Hz for 1 s, 0.15-ms
pulse width, 60 V, every 3 min as standard) commenced. In experiments to test effects of stimuli of longer duration, a period >3 min was
allowed between stimuli such that successive responses to the same
stimuli were consistent. Arterioles were visualized using video
microscopy, and the diameters of the vessels were measured continuously
using the DIAMTRAK program (T. Neild, Flinders University, Adelaide,
South Australia). The segments of arteriole studied were
located in the same general area in each experiment and were usually in
the size range of 25-35 µm. Control experiments to determine the
lifetime of the preparation were carried out. Most experiments took in
the order of 1-1.5 h total after the equilibration period.
All results were obtained with the appropriate drug present in
solution, except for the irreversible -adrenergic receptor blocker
benextramine, whose effect was determined after a washout period to
avoid nonspecific effects. When 30 mM KCl was used as a preconstricting
agent, preparations were pretreated with benextramine (105 M) to reduce the
consequences of neurotransmitter release induced by depolarization of
the nerve terminals in the high-potassium solution.
Experiments using NE were carried out in the presence of propranolol
(106 M) to eliminate
-adrenoceptor effects. Possible potentiation by low concentrations
of
[Leu31,Pro34]-
NPY of NE-induced contraction was determined by exposing preparations to NE twice, the second time in the presence of
[Leu31,Pro34]NPY.
After the first exposure, preparations were washed until standard
nerve-mediated contractions had recovered to control levels before the
second exposure.
[Leu31,Pro34]NPY
was added 10 min before the second exposure to NE. Control experiments
were performed to test the effect of two sequential applications of NE.
In experiments to test the effect of high concentrations of
[Leu31,Pro34]NPY
on low concentrations of NE, preparations were exposed to [Leu31,Pro34]NPY,
NE, or a combination of the two drugs.
To determine the role of NPY receptors in nerve-mediated responses,
experiments involved two consecutive series of nerve stimulations of
varying numbers of pulses in Krebs solution. Receptor agonists or
antagonists were added to the perfusion solution before the second
series. Results were expressed as the size of the nerve-mediated contractions after nerve stimulation in the second series as a percentage of those after the 10-pulse stimulus in the first series. In
control experiments, no drugs were added before the second series of
nerve stimulations.
Experiments involving propranolol
(106 M) to prevent
-adrenoceptor effects and capsaicin
(105 M) to prevent effects
of sensory motor nerves required a pretreatment period of 30 min. The
effectiveness of capsaicin treatment was tested using transmural
stimuli at 10 Hz for 1 s every 15 s for 2 min. In preparations in which
sensory nerves had been depleted of transmitter by capsaicin treatment,
there was no reduction in the size of the contraction evoked by
consecutive nerve stimuli (14).
Analysis of results.
Nerve- or drug-mediated contractions or dilations were expressed as a
percentage of the resting vessel diameter to account for variation in
arteriolar size between preparations. Contractions in drugs were
measured at the point of maximum amplitude. Nerve-mediated contractions
in control or drug solutions were averaged from at least three
consistent responses when possible. For consistency, preparations
displaying nerve-mediated contractions of <20% of resting vessel
diameter were discarded. All experiments were repeated at least three
times on different animals. Results are given as the means ± SE of
n samples. The significance of any
effects observed was determined using independent group analysis of
variance with 95% confidence limits, followed by unpaired or paired
t-tests (two-sided) when appropriate.
mRNA expression.
SCG and irides were dissected from animals anesthetized with a mixture
of Rompun (8 mg/kg) and ketamine (44 mg/kg) and killed by
exsanguination. The sphincter muscle and ciliary processes were removed
from the irides, leaving the dilator muscle and overlying stroma
containing the arterioles. Because of their small size, it was not
possible to further isolate the arterioles. Tissue was placed into the
single-step RNA isolation solution RNAzol B (Tel-Test) and homogenized.
RNA was precipitated from the aqueous phase according to the
manufacturer's instructions for low yields of RNA. The RNA pellet was
resuspended in tris(hydroxymethyl)aminomethane (Tris)-EDTA buffer and
stored at 
70°C.
RNA (5 µg) was used for each reverse transcription reaction in a
total volume of 50 µl. A parallel reaction, omitting the RT enzyme,
was performed as a control for contaminating DNA. The RNA was reverse
transcribed at 42°C for 90 min using 200 U RT (SuperScript II;
GIBCO), 1 mM dNTP (Pharmacia), 40 U RNAase inhibitor (Stratagene), and
300 ng random hexamer (GIBCO). The enzyme was then inactivated for 10 min at 90°C. Reaction products were stored at 20°C.
Primers were designed to span a region including the third
intracellular loop of the rat Y1-
and Y2-receptor cDNA. The
Y1-receptor sequence was obtained
from the published rat mRNA sequence (17), whereas the
Y2-receptor sequence for the rat
was kindly supplied by J. Shine (Garvan Institute, Sydney, Australia).
For the Y1 receptor, the forward
primer was ATTCCCGTCAGACTCTCACAGGC [23 base pairs (bp)] and
the reverse primer was TCCACAGATGTAGCCTGGGACCG (23 bp), generating a
589-bp fragment (667-1255 bp of published mRNA sequence). For the
Y2 receptor, the forward primer
was GGTACAGTCTACAGCCTTTCCACC (24 bp) and the reverse primer was
CAACCTCTGCTCACAGCGGAAGGC (24 bp), generating a 393-bp fragment
(646-1038 bp). PCR reactions were carried out in capillary tubes
on the Corbett FTS-1S capillary thermal cycler. Reaction volumes were
20 µl and contained 10 mM Tris · HCl (pH 9), 50 mM
KCl, 1.5 mM MgCl2, 0.01% gelatin,
0.1% Triton X-100, 0.2 mM dNTP (Pharmacia), 24 pmol of each primer, 0.2 U Supertaq enzyme (P. H. Stehelin and Cie, Basel, Switzerland), and
2 µl of cDNA. A control without cDNA was performed to test for
reagent contamination. Reactions were carried out for 30 cycles of 10 s
at 94°C, 10 s at 67°C, and 1 min at 72°C. The initial denaturation step was performed for 1 min, and the final extension step
was performed for 5 min. PCR products were gel purified and were
sequenced using the ABI PRISM dye terminator cycle sequencing ready
reaction kit (Perkin-Elmer).
| |
RESULTS |
Expression of Y1- and
Y2-receptor mRNA in SCG and iris.
Bands corresponding to the predicted sizes of PCR fragments for both
NPY Y1 and
Y2 receptors using
subtype-specific primers were seen in the brain, SCG, and iris (Fig.
1; 589 and 393 bp, respectively). A second,
fainter band of larger size was visible in the brain +RT, SCG +RT, and
iris +RT and RT lanes after gel electrophoresis of products
from PCR reactions using primers specific for
Y1 receptors.
View larger version (55K):
[in this window]
[in a new window]
|
Fig. 1.
Reverse transcriptase-polymerase chain reaction (RT-PCR) products using
primers specific for rat neuropeptide Y (NPY)
Y1
(A) and
Y2
(B) receptors generated from cDNA
from brain, superior cervical ganglion (SCG), and iris tissues.
A: NPY
Y1 receptor primers generated a
band of 589 base pairs (bp). B: NPY
Y2 receptor primers generated a
band of 393 bp. Molecular weight markers
( Hind III +  X174
Hae III) were run on both edges of the
PCR sample lanes. Lanes marked RT provided a control for
contaminating genomic DNA, whereas lanes marked
H2O contained no RNA. kb,
Kilobase.
|
|
NPY Y1- and
Y2-receptor PCR products were
sequenced in both directions and were found to be 100% homologous with
published sequences.
General observations of iris arterioles.
Control experiments were performed (n = 4) in which preparations were stimulated every 3 min for 1.5 h from
the end of the equilibration period. There was no significant change in
the size of the nerve-mediated contractions or in the resting vessel
diameter over this time. Contractions induced by stimulation were
blocked by the -adrenoceptor antagonist benextramine
(105 M) and by tetrodotoxin
(106 M). Under control
conditions, iris arterioles developed little or no tone, making
measurements of vasodilation resulting from nerve stimulation or the
addition of drugs nonsignificant. Therefore, when vasodilatory effects
of NPY agonists were studied, it was necessary to preconstrict the
arterioles (see Evidence for functional NPY
Y2
receptors).
Evidence for functional NPY Y1 receptors.
A typical time course for the contraction induced by the
Y1-receptor agonist
[Leu31,Pro34]NPY
(107 M) is shown in Fig.
2.
[Leu31,Pro34]NPY
produced a long-lasting, dose-dependent contraction of iris arterioles
with a 50% effective concentration of
108 M (Fig.
3A).
View larger version (39K):
[in this window]
[in a new window]
|
Fig. 2.
Typical time course for contraction induced by
107 M
[Leu31,Pro34]NPY.
Vessel diameter is indicated at right.
Arrows indicate nerve stimulation at 10 Hz for 1 s, giving rise to a
vasoconstriction in presence and absence of
Y1 agonist.
|
|
View larger version (16K):
[in this window]
[in a new window]
|
Fig. 3.
A: dose-response curve for
[Leu31,Pro34]NPY-induced
contraction of arterioles. Plots represent means ± SD of 3-4
experiments. Contractions were measured at point of maximum amplitude.
B: effect of
Y1 antagonist, 1229U91, on
contraction induced by 107
M
[Leu31,Pro34]NPY.
Bars represent means ± SE of 3 experiments. Contraction induced by
[Leu31,Pro34]NPY
in presence of 3 × 107 M 1229U91 is not
significantly different from 0 (P > 0.05). * Significant difference from control
(P < 0.05).
|
|
The Y1-receptor antagonist 1229U91
prevented the contraction caused by
107 M
[Leu31,Pro34]NPY
in a dose-dependent manner (Fig.
3B). In these experiments, 1229U91
had no effect by itself on resting vessel diameter. The vasoconstriction induced by
107 M and
109 M
[Leu31,Pro34]NPY
(n = 2 each) was not affected by prior
exposure to benextramine (105 M)
(P > 0.05 by unpaired
t-test; data not shown), indicating that the -adrenoceptor antagonist benextramine did not block Y1-receptor effects.
A possible role for the Y1
receptor in potentiation of NE-induced contraction was investigated
using 109 M and
1010 M
[Leu31,Pro34]NPY
concentrations, which did not by themselves produce significant contractions. The concentration of NE used
(106 M) produced a
submaximal contraction that amounted to 60% of that produced by
105 M NE (10). In control
experiments, the contraction produced by a second exposure of a
preparation to 106 M NE was
80% of that produced by the first exposure. Incubation of preparations
in
[Leu31,Pro34]NPY
(1010 M and
109 M) did not produce
potentiation of the second contraction to NE
(1010 M: 23.5 ± 5.2%,
n = 5;
109 M: 18.7 ± 3%,
n = 4; control: 25.4 ± 7% of
resting vessel diameter, n = 5).
Y1 receptors and nerve-mediated
responses.
Stimuli containing varying numbers of pulses (10, 8, 6, 5, 4, 3, 2, or
1) were given in the absence, and then in the presence, of two
concentrations (109 M and
107 M) of
[Leu31,Pro34]NPY
or 1229U91 (3 × 107
M). At 109 M
(n = 3), the agonist showed no effect
on nerve-mediated contractions. At
107 M
(n = 3), there was a significant
increase in the size of nerve-mediated contractions after short stimuli
of one to four pulses such that the response reached a maximum with
stimuli containing only four pulses (Fig.
4). The failure to see potentiation of
contractions after longer stimuli may be due to the contraction
reaching a maximum possible for the vessel, because
107 M
[Leu31,Pro34]NPY
by itself produced a large contraction (32.8 ± 1.4% of resting vessel diameter, n = 6), and in
combination with nerve stimulation (10 Hz, 1 s), the contraction
amounted to 46.2 ± 2% of resting vessel diameter
(n = 6). On the other hand, 1229U91
(n = 4) tended to reduce
nerve-mediated contractions for stimuli containing <10 pulses,
although these decreases were only significant at the 5% level for
stimuli containing four and eight pulses (Fig. 4). Under the same
conditions, prior treatment with benextramine
(105 M,
n = 4) blocked all nerve-mediated
contractions (Fig. 4).
View larger version (40K):
[in this window]
[in a new window]
|
Fig. 4.
Effect of control (open bars; n = 5),
109 M
[Leu31,Pro34]NPY
(hatched bars; n = 3),
107 M
[Leu31,Pro34]NPY
(solid bars; n = 3), 3 × 107 M 1229U91 (crosshatched
bars; n = 3), and
105 M benextramine (BNX;
shaded bars; n = 5) on nerve-mediated
contractions after stimuli in the range of 10 Hz, 1-10 pulses.
Results are presented for contractions in a second series of nerve
stimulations, expressed as percentages of contractions at 10 Hz, 10 pulses in the first series of nerve stimulations. Bars represent means ± SE. * Significant difference from matched control
(P < 0.05).
|
|
Because of the potentiating effects of a high concentration
(107 M) of
[Leu31,Pro34]NPY
on responses to low concentrations of NE released by brief nerve
stimuli, we tested the effect of
107 M
[Leu31,Pro34]NPY
against responses to exogenous NE. For these experiments, it was
necessary to use a lower concentration of NE
(107 M), which caused only
a small contraction (7.5 ± 2.8% of resting vessel diameter,
n = 7), because contractions produced
by both 107 M
[Leu31,Pro34]NPY
and 106 M NE were large
[32.8 ± 1.4% (n = 6) and
30.8 ± 3.2% of resting vessel diameter
(n = 8), respectively] and their
combination could well have exceeded the maximum possible for the
vessel.
The combination of 107 M
[Leu31,Pro34]NPY
with 107 M NE produced
contractions of 46.9 ± 1.4% (n = 6). According to the isobole method (see Ref. 3), the combination
of agents is synergistic if
[(da/Da) + (db/Db)] < 1, where da and
db are the doses of A and B in the combination and Da and
Db are the doses of A and B which
separately are isoeffective with the combination.
Because
[Leu31,Pro34]NPY
did not produce the effect of the combination at 3 × 107 M (36.3 ± 0.7%,
n = 3; see Fig.
3A), then
Da is >3 × 107 M. Similarly, because
NE did not produce the effect of the combination at
106 M,
Db is
>106 M. The equation then
becomes (107/>3 × 107) + (107/>106)
(i.e., <
+ <
, or <1). We can therefore
speculate that there is synergism between the two agents
[Leu31,Pro34]NPY
and NE when each is present at
107 M.
Evidence for functional NPY Y2 receptors.
No contractile response was seen when the
Y2-receptor agonist
N-acetyl-[Leu28,Leu31]NPY24-36
was added to the bath at
107 M
(n = 4).
Because of the absence of tone of iris arterioles in the
resting condition, it was necessary to test for possible
vasodilatory effects of
N-acetyl-[Leu28,Leu31]NPY24-36
after preconstriction. We used either 30 mM KCl Krebs solution or the
2-adrenergic agonist
UK-14304-18 (107 M) for
this purpose. Both of these solutions caused a submaximal contraction
(79% and 38% of the constrictions in 50 mM KCl, respectively). Against vasoconstriction induced by 30 mM KCl Krebs solution, there was
no effect of
N-acetyl-[Leu28,Leu31]NPY24-36
at concentrations of either
108 M
(n = 3) or
107 M
(n = 3). In the presence of prazosin,
instead of benextramine, to block effects of neurally released NE by
the 30 mM KCl Krebs solution, there was again no effect of either
107 or 3 × 107 M
N-acetyl-[Leu28,Leu31]NPY24-36
(n = 1 each). There was also no
attenuation of the contraction induced by 30 mM KCl Krebs solution when
N-acetyl-[Leu28,Leu31]NPY24-36
(108 M) was added to the
solution 5 min before the 30 mM KCl Krebs solution (control: 32.4 ± 2.3%, n = 9;
N-acetyl-[Leu28,Leu31]NPY24-36:
29.6 ± 2.4%, n = 3).
Against preconstriction induced by UK-14304-18
(107 M),
N-acetyl-[Leu28,Leu31]NPY24-36
produced a small, but significant, transient vasodilation
(P < 0.05; Fig.
5). In control experiments, whereas the
constriction induced by UK-14304-18
(107 M) declined with time,
only one of seven preparations showed a comparable transient dilation.
Vasodilation, after the addition of
N-acetyl-[Leu28,Leu31]NPY24-36
or at an equivalent time in control, expressed as vessel diameter relative to the constricted diameter in UK-14304-18
(107 M), was 7.4 ± 1.1% in
N-acetyl-[Leu28,Leu31]NPY24-36
(n = 7) and 4.8 ± 0.4% in control
(n = 7).
View larger version (6K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of 108 M
N-acetyl-[Leu28,Leu31]NPY24-36
on vessels preconstricted with UK-14304-18
(107 M). Vessel diameter is
indicated at right.
|
|
Y2 receptors and nerve-mediated
responses.
There was no effect of the addition of
N-acetyl-[Leu28,Leu31]NPY24-36
(109 M,
n = 4; and
108 M,
n = 5) on contractile responses to a
range of stimuli at 10 Hz (0.1-1 s; data not shown) or to stimuli
at 20 Hz (5 s, 30 s, and 1 min; n = 3;
data not shown).
Possible masking of NPY responses.
Neither capsaicin nor propranolol, nor a combination of the two, had
any significant effect on the amplitude of contractions after nerve
stimulation at 10 Hz for 1 s (Fig.
6). After exposure to
benextramine, the nerve-mediated contraction in either capsaicin (n = 5) or propranolol
(n = 4) was totally abolished.
However, in a combination of the two antagonists
(n = 4), the nerve-mediated contractions were only reduced to ~20% of control after exposure to
benextramine. This benextramine-resistant component was greater in
preparations showing spontaneous activity. The addition of 3 × 107 M 1229U91 did not
affect this residual contraction (Fig. 6). These results suggest that
the elimination of vasodilatory -adrenergic and sensory
nerve-mediated responses uncovers a vasoconstriction, but this does not
result from the release of NPY.
View larger version (27K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of propranolol (B,
106 M) and capsaicin (C,
105 M) or both (D) on
nerve-mediated contractions before (control) and after exposure to BNX
(105 M) and BNX + 1229U91
(3 × 107 M). Bars
represent means ± SE of 3-5 experiments; A, no drugs present.
* Residual contraction in presence of both capsaicin and
propranolol, after benextramine, was significantly different from
matched control, as was that after addition of 1229U91 (3 × 107 M)
(P < 0.05). Residual contraction in
BNX was not significantly different from that in BNX + 1229U91
(P > 0.05).
|
|
Effect of increasing frequency and duration of stimuli.
Nerve stimulation at 10 Hz for 5 s (50 pulses) and 20 Hz for 5 s (100 pulses) produced significantly greater contraction amplitudes than did
stimulation at 10 Hz for 1 s (P < 0.05; Fig. 7). Furthermore, whereas
benextramine blocked contractions after stimulation at 10 Hz for 1 s,
there was a significant residual contraction after 10 and 20 Hz for 5 s
(Figs. 7 and 8). The addition of 3 × 107 M 1229U91 abolished
this residual contraction (Figs. 7 and 8).
View larger version (21K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of increasing stimulation frequency and duration on
nerve-mediated contraction after exposure to BNX
(105 M) and 1229U91 (3 × 107 M). Bars
represent means ± SE of 5 samples. * Contractions after nerve
stimulation for 5 s at either 10 or 20 Hz (B and C, respectively) were
significantly larger than those for 1 s at 10 Hz (A) both before and
after BNX (P < 0.05). 1229U91 (3 × 107 M)
significantly reduced these residual contractions
(P < 0.05, paired
t-test).
|
|
View larger version (8K):
[in this window]
[in a new window]
|
Fig. 8.
Typical trace showing effect of sequential addition of BNX
(105 M) and 1229U91 (3 × 107 M) on
contractions after stimuli of longer duration (20 Hz for 5, 30, and 60 s). Vessel diameter is indicated at
right.
|
|
Stimuli at 20 Hz with durations >5 s (30 and 60 s) were also tested
(n = 4). Whereas the amplitude of
nerve-mediated contractions did not alter significantly from those at
20 Hz for 5 s, the duration of the contractions was increased (Figs. 8
and 10). After exposure to benextramine, a significant component of the
initial contraction remained after stimulation at 20 Hz for 30 s and 20 Hz for 60 s (Figs. 8 and 9). After nerve
stimulation at 20 Hz for 60 s, a second, slow contraction was apparent
after the initial, fast contraction (Fig. 8). All these responses were
abolished with the subsequent addition of 1229U91 (Fig. 8).
View larger version (26K):
[in this window]
[in a new window]
|
Fig. 9.
Effect of sequential addition of BNX
(105 M) and 1229U91 (3 × 107 M) on size of
initial fast contraction after nerve stimulation at 10 Hz for 1 s (A),
20 Hz for 30 s (B), and 20 Hz for 60 s (C). Bars represent means ± SE of 4 experiments. Note that, after BNX, contractions B and C are
significantly greater than A. These residual contractions are abolished
by 1229U91. * Significant difference from matched control.
|
|
When 3 × 107 M
1229U91 was added without benextramine, there was no effect on the
magnitude of the initial contraction (Figs. 10 and 11),
but there was a reduction in the duration of the contraction for the
30-s and, especially, the 60-s stimulus (Fig. 10). In addition, a
dilation after the contraction was often apparent (Fig. 10).
View larger version (7K):
[in this window]
[in a new window]
|
Fig. 10.
Typical trace showing effect of 1229U91 (3 × 107 M) on contractions
after stimuli of longer duration (20 Hz for 5, 30 and 60 s). Vessel
diameter is indicated at right.
|
|
View larger version (24K):
[in this window]
[in a new window]
|
Fig. 11.
Effect of 1229U91 on size of initial fast contraction after nerve
stimulation at 10 Hz for 1 s (A), 20 Hz for 30 s (B), and 20 Hz for 60 s (C). Bars represent means ± SE of 3 experiments. Note that
1229U91 has no effect on size of initial contractions under any
stimulation conditions.
|
|
| |
DISCUSSION |
Sympathetic nerves surrounding iridial arterioles are immunoreactive
for NPY, but responses to nerve stimulation at 10 Hz for 1 s have
previously (10) been found to be entirely due to the activation by NE
of -adrenoceptors. The failure to detect responses caused by
neurally released NPY may be due to a lack of appropriate receptors,
potentiation by NPY of responses to NE, a masking of NPY effects
postsynaptically because of the simultaneous activation of receptors
mediating opposing responses, or a failure of the nerves to release
NPY.
Expression of Y1- and
Y2-receptor mRNA.
Using RT-PCR, we have shown that mRNA for both
Y1 and
Y2 receptors exists in the cells
of the SCG, which supplies sympathetic fibers to the iris, and in the
iris itself. In the iris, mRNA for the
Y1 and
Y2 receptors was expressed
approximately equally, whereas in the SCG, the
Y1 receptor was expressed more
strongly than the Y2 receptor,
with the reverse being the case for the brain. The presence of a faint
second band after PCR of
Y1-receptor cDNA indicates a small
amount of DNA contamination in the RNA samples, because a 97-bp intron
is present in the corresponding region of the human genomic sequence
spanned by the two rat NPY Y1-receptor primers (12). No
intron is present in the region of the human
Y2 receptor corresponding to the
region amplified in the present study (1), hence the need for the
controls without RT. Using similar techniques but different primers,
Nilsson, et al. (27) and Bergdahl et al. (4) have demonstrated mRNA
expression of the human Y1
receptor in cerebral and omental arteries, respectively.
Evidence for functional NPY Y1 receptors.
Protein expression of the Y1
receptor in the iris arterioles has been confirmed with dose-dependent
contractions of the arterioles after incubation with a
Y1-receptor-specific agonist,
[Leu31,Pro34]NPY,
although this does not preclude expression at the protein level in
other tissues of the iris. The response to
[Leu31,Pro34]NPY
was blocked by the Y1 antagonist
1229U91 (20) but was not affected by the -adrenoceptor antagonist
benextramine, in contrast to a previous report (33).
[Leu31,Pro34]NPY
was some 10-fold more potent than NE in iris arterioles. In other blood
vessels, in which a strong response to
[Leu31,Pro34]NPY
has been observed, there has also been an obvious potentiation of the
effects of many contractile agents (see Ref. 29), even at
concentrations at which NPY had no direct effect itself. No such
potentiation by low concentrations of
[Leu31,Pro34]NPY
of submaximal contractions of exogenous NE was seen in the present study. Although low concentrations of
[Leu31,Pro34]NPY
were not tested against lower concentrations of NE which would
themselves only produce very small contractions, low concentrations of
[Leu31, Pro34]NPY
had no effect on small NE-mediated neurogenic responses after brief
stimuli of 0.1- to 0.4-s duration. Thus, although
Y1 receptors are clearly
present postsynaptically on iris arterioles, they do not appear to
be involved in potentiation of responses to NE during exposure to low
concentrations of NPY.
The presence of high concentrations of
[Leu31,Pro34]NPY
(107 M) altered the shape
of the contractile response to increasing stimulus strength, a maximal
response being obtained with fewer pulses per stimulus, although no
potentiation was seen for the maximal responses themselves. For these
experiments, the contractile responses were expressed as a percentage
of the resting vessel diameter, because
[Leu31,Pro34]NPY
at 107 M produced a large
contraction by itself and the nerve-mediated responses were
superimposed on this. The failure to see a potentiation of the maximal
nerve-mediated response may therefore result from the vessel being
maximally constricted. In a similar fashion, [Leu31,Pro34]NPY
at 107 M was able to
potentiate the postsynaptic response to a concentration of NE that
produced only a very small contraction by itself. Lew et al. (20)
mention that a concentration of NE which produced only a small
contraction of 10% was found to produce "more robust and reliable
responses to NPY." This effect also seemed to be limited to higher
concentrations of
[Leu31,Pro34]NPY,
because low concentrations of
[Leu31,Pro34]NPY
(109 M and 3 × 108 M) did not appear to
produce any contractions larger than those caused by NE alone. Thus
[Leu31,Pro34]NPY
may be involved in postsynaptic potentiation when the amount of NPY is
relatively high and the amount of NE released is low. It is interesting
that NPY release has been shown (21) to be raised fivefold after
depletion of neuronal NE.
Evidence for functional NPY Y2 receptors.
There was little evidence for functional postsynaptic
Y2 receptors. Addition of the
Y2 agonist
N-acetyl-[Leu28, Leu31]NPY24-36
did not cause a contraction or produce a dilation of vessels preconstricted with high-potassium solutions. In these experiments, preparations were pretreated with benextramine to block activation of
-adrenoceptors by neurally released transmitters. Because Y2 receptors have been reported to
be sensitive to benextramine in washout (33), -adrenoceptors were
also blocked with prazosin (107 M). Under these
conditions, there was still no effect of
N-acetyl-[Leu28,Leu31]NPY24-36.
A small, transient dilation was often seen after
N-acetyl-[Leu28,Leu31]NPY24-36
in vessels preconstricted with the
2-adrenoceptor agonist
UK-14304-18, perhaps suggesting that the
Y2 receptor is rapidly
desensitized. There was no effect of
N-acetyl-[Leu28,Leu31]NPY24-36
on neurogenic contractions over a wide range of stimulation frequencies and durations. There was also no evidence for modulation of sympathetic vasoconstriction in blood vessels of the gracilis muscle of dogs (22),
although presynaptic inhibition via
Y2 receptors has been described in
other vascular beds (19, 24). These apparently conflicting results may
indicate some tissue-specific distribution of presynaptic NPY
receptors.
The discrepancy between the abundant mRNA expression of the
Y2 receptor and the apparent
paucity of functional protein expression in iris arterioles may suggest
that there is little correlation between receptor mRNA and protein.
Alternatively, an appropriate function for
Y2 receptors in iris arterioles
may not have been tested here, or the bulk of the
Y2 protein may be present in
tissues other than the arterioles in the iris. For the RT-PCR, the
sphincter and ciliary processes were removed, leaving the dilator
muscle and the connective tissue stroma, which also contains the
arterioles. Preliminary experiments suggest that
N-acetyl-[Leu28,Leu31]NPY24-36
has neither contractile nor relaxing effects on the dilator muscle. Alternatively, there is evidence for species specificity of peptide agonists (36). This is interesting because the previous studies (26)
describing the dilatory effects of the
N-acetyl-[Leu28, Leu31]NPY24-36
used here employed guinea pigs. There have also been reports of
differential responses to Y1 and
Y2 agonists between male and female rats (9), although animals of both sexes were used here.
Possible masking of NPY responses.
In the present and previous studies (10), the -adrenoceptor
antagonist benextramine completely blocked neurogenic responses after
nerve stimulation at 10 Hz for 1 s. Because both -adrenoceptor activation and sensory nerve activation of CGRP receptors on the smooth
muscle could produce increases in adenosine 3',5'-cyclic monophosphate (cAMP) which could antagonize the decreases in cAMP proposed to result from NPY receptor activation, it was possible that
activation of these receptors by nerve stimulation could mask the
effect of NPY release. Capsaicin, which depletes sensory motor nerves
of neurotransmitter and then inactivates them (see Ref. 15), and the
-adrenoceptor antagonist propranolol were used to test this
hypothesis. Results showed that, in the presence of both drugs, a
benextramine-insensitive component was revealed. However, this was not
blocked by the NPY antagonist 1229U91, suggesting that the residual
response was not caused by NPY.
Effect of increasing frequency and duration of stimuli.
Stimulation of perivascular nerves with stimuli of longer duration and
higher frequency produced larger and more long-lasting contractile
responses that had substantial NPY components. These results are
consistent with previous studies (21), which have shown that the
release of NPY from sympathetic nerves is significantly enhanced with
increases in the frequency of nerve stimulation. These authors also
found that the addition of propranolol unmasked a component of the
increase in perfusion pressure following nerve stimuli after blocking
-adrenoceptors. It is interesting that a dilation was recorded in
the present study when nerves were stimulated with stimuli of longer
duration and NPY effects were inhibited with 1229U91. Thus, with
stimuli of longer duration, there was evidence for interactions between
NPY vasoconstrictor effects and other nerve-mediated vasodilations.
When longer stimuli were tested (20 Hz, 30 s and 1 min), there was an
obvious initial and a delayed component to the contractions. Whereas
the initial component was unaffected by the addition of 1229U91, the
delayed component was eliminated. Consistent with these results,
pretreatment with benextramine did not affect the delayed component,
which was abolished by the subsequent addition of 1229U91, suggesting
that the delayed component resulted from the activation of
Y1 receptors after the release of
NPY. Using another Y1 antagonist
(SR120107A), Malmstrom et al. (23) showed that NPY formed a large part
of the delayed component of prolonged sympathetic contraction in a
number of vascular beds in pigs. There was also a
Y1 component of the initial
contraction, although this varied greatly between vessels (23). In the
present experiments, there was no significant effect of 1229U91 by
itself on the initial component of the contraction. On the other hand,
benextramine pretreatment reduced, but did not abolish, the initial
component of the contraction, which was abolished with the further
addition of 1229U91. These results suggest that the initial
component is usually mediated by NE but that pretreatment with
benextramine may have increased both NPY and NE release by blocking
inhibitory, presynaptic
2-adrenoceptors.
In summary, we have demonstrated that NPY
Y1 receptors are present on rat
iris arterioles. These receptors mediate vasoconstriction to exogenous
NPY and to NPY released from sympathetic nerves after stimuli of long
duration and high frequency. Responses to neurally released NPY were
slower in onset and longer in duration compared with those elicited by
neurally released NE. When activated by concentrations of NPY which
themselves cause contractions, NPY Y1 receptors mediated potentiation
of responses to a relatively ineffective concentration of NE. This
suggests that NPY may play a secondary role of potentiation when NE
levels have become depleted after prolonged, high-frequency stimuli.
| |
ACKNOWLEDGEMENTS |
The authors thank Dr. R. Murphy and Prof. J. A. Angus for generous
gifts of 1229U91 to permit these studies.
| |
FOOTNOTES |
Address for reprint requests: M. J. Newhouse, Div. of Neuroscience,
John Curtin School of Medical Research, Australian National Univ.,
Canberra, A.C.T. 0200, Australia.
Received 17 March 1997; accepted in final form 8 July 1997.
| |
REFERENCES |
1.
Ammar, D. A.,
D. M. Eadie,
D. J. Wong,
Y. Y. Ma,
L. F. Kolakowski, Jr.,
T. L. Yang-Feng,
and
D. A. Thompson.
Characterization of the human type 2 neuropeptide Y receptor gene (NPY2R) and localization to the chromosome 4q region containing the type 1 neuropeptide Y receptor gene.
Genomics
38:
392-398,
1997.
2.
Andriantsitohaina, R.,
P. Andre,
and
J. C. Stoclet.
Pertussis toxin abolishes the effect of neuropeptide Y on rat resistance arteriole contraction.
Am. J. Physiol.
259 (Heart Circ. Physiol. 28):
H1427-H1432,
1990[Abstract/Free Full Text].
3.
Berenbaum, M. C.
What is synergy?
Pharmacol. Rev.
41:
93-141,
1989[Medline].
4.
Bergdahl, A.,
T. Nilsson,
L. Cantera,
L. Nilsson,
X. Y. Sun,
T. Hedner,
D. Erlinge,
S. Valdemarson,
and
L. Edvinsson.
Neuropeptide Y potentiates noradrenaline-induced contraction through the neuropeptide Y Y1 receptor.
Eur. J. Pharmacol.
316:
59-64,
1996[Medline].
5.
Daniels, A. J.,
E. R. Lazarowski,
J. E. Matthews,
and
E. G. Lapetina.
Neuropeptide Y mobilizes intracellular Ca2+ and increases inositol phosphate production in human erythroleukemia cells.
Biochem. Biophys. Res. Commun.
165:
1138-1144,
1989[Medline].
6.
Edvinsson, L.
Characterization of the contractile effect of neuropeptide Y in feline cerebral arteries.
Acta Physiol. Scand.
125:
33-41,
1985[Medline].
7.
Fredholm, B. B.,
I. Jansen,
and
L. Edvinsson.
Neuropeptide Y is a potent inhibitor of cyclic AMP accumulation in feline cerebral blood vessels.
Acta Physiol. Scand.
124:
467-479,
1985[Medline].
8.
Fuhlendorf, J.,
U. Gether,
L. Aakerlund,
N. Langeland-Johansen,
H. Thogersen,
S. G. Melberg,
U. B. Olsen,
O. Thastrup,
and
T. W. Schwartz.
[Leu31,Pro34]neuropeptide Y: a specific Y1 receptor agonist.
Proc. Natl. Acad. Sci. USA
87:
182-186,
1990[Abstract/Free Full Text].
9.
Glenn, T. C.,
D. N. Krause,
and
S. P. Duckles.
Vascular responses to neuropeptide Y are greater in female than male rats.
Naunyn Schmiedebergs Arch. Pharmacol.
355:
111-118,
1997[Medline].
10.
Gould, D. J.,
and
C. E. Hill.
Alpha1B-receptors and intracellular calcium mediate sympathetic nerve induced constriction of rat irideal blood vessels.
J. Auton. Nerv. Syst.
50:
139-150,
1994[Medline].
11.
Grundemar, L.,
S. E. Jonas,
N. Morner,
E. D. Hogestatt,
C. Wahlestedt,
and
R. Hakanson.
Characterization of vascular neuropeptide Y receptors.
Br. J. Pharmacol.
105:
45-50,
1992[Medline].
12.
Herzog, H.,
M. Baumgartner,
C. Vivero,
L. A. Selbie,
B. Auer,
and
J. Shine.
Genomic organization, localization, and allelic differences in the gene for the human neuropeptide Y Y1 receptor.
J. Biol. Chem.
268:
6703-6707,
1993[Abstract/Free Full Text].
13.
Herzog, H.,
Y. J. Hort,
H. J. Ball,
G. Hayes,
J. Shine,
and
L. A. Selbie.
Cloned human neuropeptide Y receptor couples to two different second messenger systems.
Proc. Natl. Acad. Sci. USA
89:
5794-5798,
1992[Abstract/Free Full Text].
14.
Hill, C. E.,
and
D. J. Gould.
Modulation of sympathetic vasoconstriction by sensory nerves and nitric oxide in rat irideal arterioles.
J. Pharmacol. Exp. Ther.
273:
918-926,
1995[Abstract/Free Full Text].
15.
Holzer, P.
Capsaicin: cellular targets, mechanisms of action, and selectivity for thin sensory neurons.
Pharmacol. Rev.
43:
143-201,
1991[Medline].
16.
Kawasaki, H.,
C. Nuki,
A. Saito,
and
K. Takasaki.
NPY modulates neurotransmission of CGRP-containing vasodilator nerves in rat mesenteric arteries.
Am. J. Physiol.
261 (Heart Circ. Physiol. 30):
H683-H690,
1991[Abstract/Free Full Text].
17.
Krause, J.,
C. Eva,
P. H. Seeburg,
and
R. Sprengel.
Neuropeptide Y1 subtype pharmacology of a recombinantly expressed neuropeptide receptor.
Mol. Pharmacol.
41:
817-821,
1992[Abstract].
18.
Lacroix, J. S.,
P. Stjarne,
A. Anggard,
and
J. M. Lundberg.
Sympathetic vascular control of the pig nasal mucosa (II): reserpine-resistant, non-adrenergic nervous responses in relation to neuropeptide Y and ATP.
Acta Physiol. Scand.
133:
183-197,
1988[Medline].
19.
Lacroix, J. S.,
L. G. Ulman,
and
E. K. Potter.
Modulation by neuropeptide Y of parasympathetic nerve-evoked nasal vasodilation via Y2 prejunctional receptor.
Br. J. Pharmacol.
113:
479-484,
1994[Medline].
20.
Lew, M. J.,
R. Murphy,
and
J. A. Angus.
Synthesis and characterization of a selective peptide antagonist of neuropeptide Y vascular postsynaptic receptors.
Br. J. Pharmacol.
117:
1768-1772,
1996[Medline].
21.
Lundberg, J. M.,
A. Rudehill,
A. Sollevi,
E. Theodorsson-Norheim,
and
B. Hamberger.
Frequency- and reserpine-dependent chemical coding of sympathetic transmission: differential release of noradrenaline and neuropeptide Y from pig spleen.
Neurosci. Lett.
63:
93-100,
1986.
22.
Mahns, D. A.,
M. L. Revington,
M. J. Runcie,
I. McCloskey,
and
E. K. Potter.
Inhibition of sympathetic cholinergic vasodilation by a selective neuropeptide Y Y2 receptor agonist in gracilis muscle in anaesthetised dogs.
Proc. Aust. Neurosci. Soc.
8:
30,
1997.
23.
Malmstrom, R. E.,
A. Modin,
and
J. M. Lundberg.
SR 120107A antagonizes neuropeptide Y Y1 receptor mediated sympathetic vasoconstriction in pigs in vivo.
Eur. J. Pharmacol.
305:
145-154,
1996[Medline].
24.
McAuley, M. A.,
and
T. C. Westfall.
Possible location and function of neuropeptide Y receptor subtypes in the rat mesenteric arterial bed.
J. Pharmacol. Exp. Ther.
261:
863-868,
1992[Abstract/Free Full Text].
25.
Morris, J. L.
Selective constriction of small cutaneous arteries by NPY matches distribution of NPY in sympathetic axons.
Regul. Pept.
49:
225-236,
1994[Medline].
26.
Neild, T. O.,
and
C. J. Lewis.
Reduction of vasoconstriction mediated by neuropeptide Y Y2 receptors in arterioles of the guinea-pig small intestine.
Br. J. Pharmacol.
115:
220-221,
1995[Medline].
27.
Nilsson, T.,
L. Cantera,
and
L. Edvinsson.
Presence of neuropeptide Y Y1 receptor mediating vasoconstriction in human cerebral arteries.
Neurosci. Lett.
204:
145-148,
1996[Medline].
28.
Olson, L.,
C. Ayer-Le Lievre,
H. Bjorklund,
T. Ebendal,
A.-C. Granholm,
K.-O. Hedlund,
T. Hokfelt,
T. Melander,
A. Seiger,
and
I. Stromberg.
The innervation apparatus of the rodent iris.
In: The Peripheral Nervous System, edited by A. Bjorklund,
T. Hokfelt,
and C. Owman. Amsterdam: Elsevier Science, 1988, vol. 6, p. 545-593.
29.
Potter, E. K.
Neuropeptide Y as an autonomic neurotransmitter.
Pharmacol. Ther.
37:
251-273,
1988[Medline].
30.
Potter, E. K.,
J. A. Barden,
M. J. D. McCloskey,
L. A. Selbie,
A. Tseng,
H. Herzog,
and
J. Shine.
A novel neuropeptide Y analog, N-acetyl[Leu28,Leu31]neuropeptide Y-(24-26), with functional specificity for the presynaptic (Y2) receptor.
Eur. J. Pharmacol.
267:
253-262,
1994[Medline].
31.
Saville, V. L.,
K. I. Maynard,
and
G. Burnstock.
Neuropeptide Y potentiates purinergic as well as adrenergic responses of the rabbit ear artery.
Eur. J. Pharmacol.
176:
117-125,
1990[Medline].
32.
Tanaka, Y.,
T. Nakazawa,
H. Ishiro,
M. Saito,
H. Uneyama,
S. Iwata,
K. Ishii,
and
K. Nakayama.
Ca2+ handling mechanisms underlying neuropeptide Y-induced contraction in canine basilar artery.
Eur. J. Pharmacol.
289:
59-66,
1995[Medline].
33.
Tessel, R. E.,
D. W. Miller,
G. A. Misse,
X. Dong,
and
M. B. Doughty.
Characterization of vascular postsynaptic NPY receptor function and regulation and differential sensitivity of Y1 and Y2 receptor function to changes in extracellular calcium availability and prior in vitro peptide exposure.
Neuropeptides
25:
289-298,
1993[Medline].
34.
Toth, P. T.,
V. P. Bindokas,
D. Bleakman,
W. F. Colmers,
and
R. J. Miller.
Mechanism of presynaptic inhibition by neuropeptide Y at sympathetic nerve terminals.
Nature
364:
635-639,
1993[Medline].
35.
Watson, S., and D. Girdlestone. 1996 receptor and ion
channel nomenclature. Trends Pharmacol. Sci.
supplement: Seventh Edition 1996.
36.
Wieland, H. A.,
K. Willim,
and
H. N. Doods.
Receptor binding profiles of NPY analogues and fragments in different tissues and cell lines.
Peptides
16:
1389-1394,
1995[Medline].
37.
Xia, J.,
T. O. Neild,
and
N. Kotecha.
Effects of neuropeptide Y and agonists selective for neuropeptide Y receptor sub-types on arterioles of the guinea-pig small intestine and the rat brain.
Br. J. Pharmacol.
107:
771-776,
1992[Medline].
AJP Heart Circ Physiol 273(5):H2119-H2127
0363-6135/97 $5.00
Copyright © 1997 the American Physiological Society
Top
Abstract
Introduction
